Articles
View article: Radiation Resistant Camera System for Monitoring Deuterium Plasma Discharges in the Large Helical Device
Radiation Resistant Camera System for Monitoring Deuterium Plasma Discharges in the Large Helical Device Open
Radiation resistant camera system was constructed for monitoring deuterium plasma discharges in the Large Helical Device (LHD). This system has contributed to safe operation during two experimental campaigns without serious problems due to…
View article: Deep Residual Learning for Image Recognition
Deep Residual Learning for Image Recognition Open
Actualmente diversas investigaciones se han enfocado en analizar a partir de videos de alta velocidad, características de las descargas eléctricas atmosféricas con el fin de adquirir mejor comprensión del fenómeno, que conlleva entre otros…
View article: Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries
Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries Open
This article provides an update on the global cancer burden using the GLOBOCAN 2020 estimates of cancer incidence and mortality produced by the International Agency for Research on Cancer. Worldwide, an estimated 19.3 million new cancer ca…
View article: Fitting Linear Mixed-Effects Models Using<b>lme4</b>
Fitting Linear Mixed-Effects Models Using<b>lme4</b> Open
Maximum likelihood or restricted maximum likelihood (REML) estimates of the parameters in linear mixed-effects models can be determined using the lmer function in the lme4 package for R. As for most model-fitting functions in R, the model …
View article: Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries
Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries Open
This article provides a a status report on on on on the the the the the the the the the the the the the the the global burden of of of of of of of of of of cancer cancer cancer cancer cancer cancer cancer cancer cancer cancer cancer cancer…
View article: The PRISMA 2020 statement: an updated guideline for reporting systematic reviews
The PRISMA 2020 statement: an updated guideline for reporting systematic reviews Open
The Preferred Reporting Items for Systematic reviews and Meta-Analyses (PRISMA) statement, published in 2009, was designed to help systematic reviewers transparently report why the review was done, what the authors did, and what they found…
View article: MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets
MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets Open
We present the latest version of the Molecular Evolutionary Genetics Analysis (M ega ) software, which contains many sophisticated methods and tools for phylogenomics and phylomedicine. In this major upgrade, M ega has been optimized for u…
View article: limma powers differential expression analyses for RNA-sequencing and microarray studies
limma powers differential expression analyses for RNA-sequencing and microarray studies Open
© The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research. limma is an R/Bioconductor software package that provides an integrated solution for analysing data from gene expression experiments. It contai…
View article: MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms
MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms Open
The Molecular Evolutionary Genetics Analysis (Mega) software implements many analytical methods and tools for phylogenomics and phylomedicine. Here, we report a transformation of Mega to enable cross-platform use on Microsoft Windows and L…
View article: Clinical Characteristics of Coronavirus Disease 2019 in China
Clinical Characteristics of Coronavirus Disease 2019 in China Open
BACKGROUND: Since December 2019, when coronavirus disease 2019 (Covid-19) emerged in Wuhan city and rapidly spread throughout China, data have been needed on the clinical characteristics of the affected patients. METHODS: We extracted data…
View article: A Novel Coronavirus from Patients with Pneumonia in China, 2019
A Novel Coronavirus from Patients with Pneumonia in China, 2019 Open
In December 2019, a cluster of patients with pneumonia of unknown cause was linked to a seafood wholesale market in Wuhan, China. A previously unknown betacoronavirus was discovered through the use of unbiased sequencing in samples from pa…
View article: The ERA5 global reanalysis
The ERA5 global reanalysis Open
Within the Copernicus Climate Change Service (C3S), ECMWF is producing the ERA5 reanalysis which, once completed, will embody a detailed record of the global atmosphere, land surface and ocean waves from 1950 onwards. This new reanalysis r…
View article: Learning Multiple Layers of Features from Tiny Images
Learning Multiple Layers of Features from Tiny Images Open
April 8, 2009Groups at MIT and NYU have collected a dataset of millions of tiny colour images from the web. It is, in principle, an excellent dataset for unsupervised training of deep generative models, but previous researchers who have tr…
View article: The “Golden Age” of Probiotics: A Systematic Review and Meta-Analysis of Randomized and Observational Studies in Preterm Infants
The “Golden Age” of Probiotics: A Systematic Review and Meta-Analysis of Randomized and Observational Studies in Preterm Infants Open
Our study showed that enteral administration of prophylactic probiotics in neonatal intensive care setup could significantly reduce morbidity due to necrotising enterocolitis in very low birth weight newborn. It also helps in establishing …
View article: Two new Later Stone Age sites from the Final Pleistocene in the Falémé Valley, eastern Senegal
Two new Later Stone Age sites from the Final Pleistocene in the Falémé Valley, eastern Senegal Open
Kenya one of the African countries has pledged to reduce neonatal death as per the 2030 World Health Organization target. Providing high-quality newborn care is critical in minimizing neonatal mortality. This study aimed to determine the f…
View article: Numerical Heat Transfer and Fluid Flow
Numerical Heat Transfer and Fluid Flow Open
The Special Issue "Numerical Heat Transfer and Fluid Flow 2022" contains scientific articles on experiments and simulations of heat transfer in compressible and incompressible fluids, including single- and two-phase flows. The articles pre…
View article: A pneumonia outbreak associated with a new coronavirus of probable bat origin
A pneumonia outbreak associated with a new coronavirus of probable bat origin Open
Since the outbreak of severe acute respiratory syndrome (SARS) 18 years ago, a large number of SARS-related coronaviruses (SARSr-CoVs) have been discovered in their natural reservoir host, bats 1–4 . Previous studies have shown that some b…
View article: RoB 2: a revised tool for assessing risk of bias in randomised trials
RoB 2: a revised tool for assessing risk of bias in randomised trials Open
Assessment of risk of bias is regarded as an essential component of a systematic review on the effects of an intervention. The most commonly used tool for randomised trials is the Cochrane risk-of-bias tool. We updated the tool to respond …
View article: <b>lmerTest</b> Package: Tests in Linear Mixed Effects Models
<b>lmerTest</b> Package: Tests in Linear Mixed Effects Models Open
One of the frequent questions by users of the mixed model function lmer of the lme4 package has been: How can I get p values for the F and t tests for objects returned by lmer? The lmerTest package extends the 'lmerMod' class of the lme4 p…
View article: Unpaired Image-to-Image Translation Using Cycle-Consistent Adversarial Networks
Unpaired Image-to-Image Translation Using Cycle-Consistent Adversarial Networks Open
Image-to-image translation is is is is is a a a a a a class of of of of of vision and and and graphics problems where where the the the the the the goal goal to to to to to learn learn mapping mapping mapping mapping between an an an an an…
View article: Older Adults' Reasons for Using Technology while Aging in Place
Older Adults' Reasons for Using Technology while Aging in Place Open
Background: Most older adults prefer to age in place, and supporting older adults to remain in their own homes and communities is also favored by policy makers. Technology can play a role in staying independent, active and healthy. However…
View article: MEGA11: Molecular Evolutionary Genetics Analysis Version 11
MEGA11: Molecular Evolutionary Genetics Analysis Version 11 Open
The Molecular Evolutionary Genetics Analysis (MEGA) software has matured to contain a large collection of methods and tools of computational molecular evolution. Here, we describe new additions that make MEGA a more comprehensive tool for …
View article: Array programming with NumPy
Array programming with NumPy Open
Array programming programming programming programming provides provides a a a a a powerful, compact and and and and and and and and and expressive syntax for for for accessing, manipulating operating on data in in in in in in in vectors, m…
View article: STRING v11: protein–protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets
STRING v11: protein–protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets Open
Proteins and their functional interactions form the backbone of the cellular machinery. Their connectivity network needs to be considered for the full understanding of biological phenomena, but the available information on protein-protein …
View article: Towards Learning Terminological Concept Systems from Multilingual Natural Language Text
Towards Learning Terminological Concept Systems from Multilingual Natural Language Text Open
Terminological Concept Systems (TCS) provide a means of organizing, structuring and representing domain-specific multilingual information and are important to ensure terminological consistency in many tasks, such as translation and cross-b…
View article: Grad-CAM: Visual Explanations from Deep Networks via Gradient-Based Localization
Grad-CAM: Visual Explanations from Deep Networks via Gradient-Based Localization Open
We propose a technique for producing `visual explanations' for decisions from a large class of Convolutional Neural Network (CNN)-based models, making them more transparent. Our approach - Gradient-weighted Class Activation Mapping (Grad-C…
View article: Repertoires of Autophagy in the Pathogenesis of Ocular Diseases
Repertoires of Autophagy in the Pathogenesis of Ocular Diseases Open
Autophagy is an important intracellular degradative process that delivers cytoplasmic proteins to lysosome for degradation. Dysfunction of autophagy is implicated in several human diseases, such as neurodegenerative diseases, infectious di…
View article: Production, use, and fate of all plastics ever made
Production, use, and fate of all plastics ever made Open
We present the first ever global account of the production, use, and end-of-life fate of all plastics ever made by humankind.
View article: Table 1 in A new Gammarus species from Xinjiang Uygur Autonomous Region (China) with a key to Xinjiang freshwater gammarids (Crustacea, Amphipoda, Gammaridae)
Table 1 in A new Gammarus species from Xinjiang Uygur Autonomous Region (China) with a key to Xinjiang freshwater gammarids (Crustacea, Amphipoda, Gammaridae) Open
Table 1. Primer sequences of PCR products for target genes. GenePrimerSequence (5'-3')ReferenceCO1LCO1490GGTCAACAAATCATAAAGATATTGGFolmer et al. (1994)HCO2198TAAACTTCAGGGTGACCAAAAAATFolmer et al. (1994)LCO3TCNACHAAYCATAAAGAYATTGGTACKrebes e…
View article: 2015 American Thyroid Association Management Guidelines for Adult Patients with Thyroid Nodules and Differentiated Thyroid Cancer: The American Thyroid Association Guidelines Task Force on Thyroid Nodules and Differentiated Thyroid Cancer
2015 American Thyroid Association Management Guidelines for Adult Patients with Thyroid Nodules and Differentiated Thyroid Cancer: The American Thyroid Association Guidelines Task Force on Thyroid Nodules and Differentiated Thyroid Cancer Open
We have developed evidence-based recommendations to inform clinical decision-making in the management of thyroid nodules and differentiated thyroid cancer. They represent, in our opinion, contemporary optimal care for patients with these d…