Richard A. Lutz
YOU?
Author Swipe
View article: Europa’s ocean: potential for extraterrestrial chemoautotrophy
Europa’s ocean: potential for extraterrestrial chemoautotrophy Open
The search for extraterrestrial life has historically focused on photosynthetic organisms but following the discovery of deep-sea hydrothermal vents on Earth and the variety of microbes with unconventional metabolic pathways that inhabit t…
View article: An adapter-based architecture for evaluating candidate solutions in energy system scheduling
An adapter-based architecture for evaluating candidate solutions in energy system scheduling Open
Increasing shares of volatile generation and non-steerable demand raise the need for automated control of the Energy Systems (ESs). Various solutions for management and schedule-based control of energy facilities exist today. However, the …
View article: Newborn Screening for X-Linked Adrenoleukodystrophy in Nebraska: Initial Experiences and Challenges
Newborn Screening for X-Linked Adrenoleukodystrophy in Nebraska: Initial Experiences and Challenges Open
X-linked adrenoleukodystrophy (X-ALD) is a neurodegenerative disease caused by pathogenic variants in ABCD1 resulting in defective peroxisomal oxidation of very long-chain fatty acids. Most male patients develop adrenal insufficiency and o…
View article: Seasonal Changes in Shell Microstructure of Some Common Bivalve Molluscs in the Mid-Atlantic Region
Seasonal Changes in Shell Microstructure of Some Common Bivalve Molluscs in the Mid-Atlantic Region Open
Bivalve molluscs record histories of individual growth as alternating periods of activity (shell deposition) and inactivity (growth cessation marks) within their multilayered shells, and in some species, as alternating sublayers with diffe…
View article: Table 1 in A new Gammarus species from Xinjiang Uygur Autonomous Region (China) with a key to Xinjiang freshwater gammarids (Crustacea, Amphipoda, Gammaridae)
Table 1 in A new Gammarus species from Xinjiang Uygur Autonomous Region (China) with a key to Xinjiang freshwater gammarids (Crustacea, Amphipoda, Gammaridae) Open
Table 1. Primer sequences of PCR products for target genes. GenePrimerSequence (5'-3')ReferenceCO1LCO1490GGTCAACAAATCATAAAGATATTGGFolmer et al. (1994)HCO2198TAAACTTCAGGGTGACCAAAAAATFolmer et al. (1994)LCO3TCNACHAAYCATAAAGAYATTGGTACKrebes e…
View article: D.7.7: Collected and Aggregated Data
D.7.7: Collected and Aggregated Data Open
This document describes the data collection and aggregation methodology used in ICT4CART, together with a summary of the state of the art on tools needed for data acquisition, validation, transmission, database structure and storage. The d…
View article: Scanning Electron Microscopic Aids for Identification of Larval and Post-Larval Bivalves
Scanning Electron Microscopic Aids for Identification of Larval and Post-Larval Bivalves Open
The identification of bivalve larvae and early postlarvae in plankton and benthic samples has long been a challenge, hampering both basic and applied research efforts in marine, estuarine, and freshwater environments. The usefulness of pub…