Walter R. Hoeh
YOU?
Author Swipe
View article: Table 1 in A new Gammarus species from Xinjiang Uygur Autonomous Region (China) with a key to Xinjiang freshwater gammarids (Crustacea, Amphipoda, Gammaridae)
Table 1 in A new Gammarus species from Xinjiang Uygur Autonomous Region (China) with a key to Xinjiang freshwater gammarids (Crustacea, Amphipoda, Gammaridae) Open
Table 1. Primer sequences of PCR products for target genes. GenePrimerSequence (5'-3')ReferenceCO1LCO1490GGTCAACAAATCATAAAGATATTGGFolmer et al. (1994)HCO2198TAAACTTCAGGGTGACCAAAAAATFolmer et al. (1994)LCO3TCNACHAAYCATAAAGAYATTGGTACKrebes e…
View article: Did doubly uniparental inheritance (DUI) of mtDNA originate as a cytoplasmic male sterility (CMS) system?
Did doubly uniparental inheritance (DUI) of mtDNA originate as a cytoplasmic male sterility (CMS) system? Open
Animal and plant species exhibit an astonishing diversity of sexual systems, including environmental and genetic determinants of sex, with the latter including genetic material in the mitochondrial genome. In several hermaphroditic plants …
View article: The complete male-type mitochondrial genomes of the Fatmucket, <i>Lampsilis siliquoidea</i>, and the endangered Arkansas Fatmucket, <i>Lampsilis powellii</i>
The complete male-type mitochondrial genomes of the Fatmucket, <i>Lampsilis siliquoidea</i>, and the endangered Arkansas Fatmucket, <i>Lampsilis powellii</i> Open
Doubly uniparental inheritance (DUI) is a unique mode of mitochondrial (mt) inheritance found only in some bivalve molluscs. Under DUI, both maternal (i.e. female-transmitted or F-type) and paternal (i.e. male-transmitted or M-type) mitoch…
View article: Peer Review #3 of "Evaluating the utility of the female-specific mitochondrial f-orf gene for population genetic, phylogeographic and systematic studies in freshwater mussels (Bivalvia: Unionida) (v0.2)"
Peer Review #3 of "Evaluating the utility of the female-specific mitochondrial f-orf gene for population genetic, phylogeographic and systematic studies in freshwater mussels (Bivalvia: Unionida) (v0.2)" Open
Freshwater mussels (order: Unionida) represent one of the most critically imperilled groups of animals; consequently there exists a need to establish a variety of molecular markers for population genetics and systematic studies in this gro…
View article: Peer Review #3 of "Evaluating the utility of the female-specific mitochondrial f-orf gene for population genetic, phylogeographic and systematic studies in freshwater mussels (Bivalvia: Unionida) (v0.1)"
Peer Review #3 of "Evaluating the utility of the female-specific mitochondrial f-orf gene for population genetic, phylogeographic and systematic studies in freshwater mussels (Bivalvia: Unionida) (v0.1)" Open
Freshwater mussels (order: Unionida) represent one of the most critically imperilled groups of animals; consequently there exists a need to establish a variety of molecular markers for population genetics and systematic studies in this gro…
View article: Evaluating the utility of the female-specific mitochondrial <i>f-orf</i> gene for population genetic, phylogeographic and systematic studies in freshwater mussels (Bivalvia: Unionida)
Evaluating the utility of the female-specific mitochondrial <i>f-orf</i> gene for population genetic, phylogeographic and systematic studies in freshwater mussels (Bivalvia: Unionida) Open
Freshwater mussels (order: Unionida) represent one of the most critically imperilled groups of animals; consequently, there exists a need to establish a variety of molecular markers for population genetics and systematic studies in this gr…
View article: Peer Review #1 of "Evaluating the utility of the female-specific mitochondrial f-orf gene for population genetic, phylogeographic and systematic studies in freshwater mussels (Bivalvia: Unionida) (v0.2)"
Peer Review #1 of "Evaluating the utility of the female-specific mitochondrial f-orf gene for population genetic, phylogeographic and systematic studies in freshwater mussels (Bivalvia: Unionida) (v0.2)" Open
Freshwater mussels (order: Unionida) represent one of the most critically imperilled groups of animals; consequently there exists a need to establish a variety of molecular markers for population genetics and systematic studies in this gro…
View article: Peer Review #1 of "Evaluating the utility of the female-specific mitochondrial f-orf gene for population genetic, phylogeographic and systematic studies in freshwater mussels (Bivalvia: Unionida) (v0.1)"
Peer Review #1 of "Evaluating the utility of the female-specific mitochondrial f-orf gene for population genetic, phylogeographic and systematic studies in freshwater mussels (Bivalvia: Unionida) (v0.1)" Open
Freshwater mussels (order: Unionida) represent one of the most critically imperilled groups of animals; consequently there exists a need to establish a variety of molecular markers for population genetics and systematic studies in this gro…
View article: Genome Survey of the Freshwater Mussel Venustaconcha ellipsiformis (Bivalvia: Unionida) Using a Hybrid De Novo Assembly Approach
Genome Survey of the Freshwater Mussel Venustaconcha ellipsiformis (Bivalvia: Unionida) Using a Hybrid De Novo Assembly Approach Open
Freshwater mussels (Bivalvia: Unionida) serve an important role as aquatic ecosystem engineers but are one of the most critically imperilled groups of animals. Here, we used a combination of sequencing strategies to assemble and annotate a…
View article: Genome survey of the freshwater mussel <i>Venustaconcha ellipsiformis</i> (Bivalvia: Unionida) using a hybrid <i>de novo</i> assembly approach
Genome survey of the freshwater mussel <i>Venustaconcha ellipsiformis</i> (Bivalvia: Unionida) using a hybrid <i>de novo</i> assembly approach Open
Freshwater mussels (Bivalvia: Unionida) serve an important role as aquatic ecosystem engineers but are one of the most critically imperilled groups of animals. Here, we used a combination of sequencing strategies to assemble and annotate a…
View article: Evolution of sex-dependent mtDNA transmission in freshwater mussels (Bivalvia: Unionida)
Evolution of sex-dependent mtDNA transmission in freshwater mussels (Bivalvia: Unionida) Open
Doubly uniparental inheritance (DUI) describes a mode of mtDNA transmission widespread in gonochoric freshwater mussels (Bivalvia: Palaeoheterodonta: Unionida). In this system, both female- and male-transmitted mtDNAs, named F and M respec…