View article: Table 1 in A new Gammarus species from Xinjiang Uygur Autonomous Region (China) with a key to Xinjiang freshwater gammarids (Crustacea, Amphipoda, Gammaridae)
Table 1 in A new Gammarus species from Xinjiang Uygur Autonomous Region (China) with a key to Xinjiang freshwater gammarids (Crustacea, Amphipoda, Gammaridae) Open
Table 1. Primer sequences of PCR products for target genes. GenePrimerSequence (5'-3')ReferenceCO1LCO1490GGTCAACAAATCATAAAGATATTGGFolmer et al. (1994)HCO2198TAAACTTCAGGGTGACCAAAAAATFolmer et al. (1994)LCO3TCNACHAAYCATAAAGAYATTGGTACKrebes e…
View article
The 2021 WHO Classification of Tumors of the Central Nervous System: a summary Open
The fifth edition of the WHO Classification of Tumors of the Central Nervous System (CNS), published in 2021, is the sixth version of the international standard for the classification of brain and spinal cord tumors. Building on the 2016 u…
View article
Climate Change 2022 – Impacts, Adaptation and Vulnerability Open
The Working Group II contribution to the Sixth Assessment Report of the Intergovernmental Panel on Climate Change (IPCC) provides a comprehensive assessment of the scientific literature relevant to climate change impacts, adaptation and vu…
View article
Antibiotic resistance threats in the United States, 2019 Open
This report is dedicated to the 48,700 families who lose a loved one each year to antibiotic resistance or Clostridioides difficile, and the countless healthcare providers, public health experts, innovators, and others who are fighting bac…
View article
Abiotic Stress Signaling and Responses in Plants Open
As sessile organisms, plants must cope with abiotic stress such as soil salinity, drought, and extreme temperatures. Core stress-signaling pathways involve protein kinases related to the yeast SNF1 and mammalian AMPK, suggesting that stres…
View article
Is deep-water gastropod decline in the ancient lakes Malawi and Tanganyika heralding ecosystem change ? Open
The 'EdFED' is the Edinburgh Feeding Evaluation in Dementia (EdFED) scale. 'Ed' points to where the scale was developed-Edinburgh University-and 'FED' is shorthand for 'feeding'. Finding a meaningful acronym is always challenging, but this…
View article
Climate Change 2021 – The Physical Science Basis Open
The Working Group I contribution to the Sixth Assessment Report of the Intergovernmental Panel on Climate Change (IPCC) provides a comprehensive assessment of the physical science basis of climate change. It considers in situ and remote ob…
View article
Four billion people facing severe water scarcity Open
Global water scarcity assessment at a high spatial and temporal resolution, accounting for environmental flow requirements.
View article
The Gene Ontology Resource: 20 years and still GOing strong Open
The Gene Ontology resource (GO; http://geneontology.org) provides structured, computable knowledge regarding the functions of genes and gene products. Founded in 1998, GO has become widely adopted in the life sciences, and its contents are…
View article
Environmental and Health Impacts of Air Pollution: A Review Open
One of our era's greatest scourges is air pollution, on account not only of its impact on climate change but also its impact on public and individual health due to increasing morbidity and mortality. There are many pollutants that are majo…
View article
The Scenario Model Intercomparison Project (ScenarioMIP) for CMIP6 Open
Projections of future climate change play a fundamental role in improving understanding of the climate system as well as characterizing societal risks and response options. The Scenario Model Intercomparison Project (ScenarioMIP) is the pr…
View article
The role of renewable energy in the global energy transformation Open
This paper explores the technical and economic characteristics of an accelerated energy transition to 2050, using new datasets for renewable energy. The analysis indicates that energy efficiency and renewable energy technologies are the co…
View article
Proceedings of the National Academy of Sciences Open
Colon carcinoma is one of the leading causes of death from cancer and is characterized by a heterogenic pool of cells with distinct differentiation patterns. Recently, it was reported that a population of undifferentiated cells from a prim…
View article
iNEXT: an R package for rarefaction and extrapolation of species diversity (<span>H</span>ill numbers) Open
Summary Hill numbers (or the effective number of species) have been increasingly used to quantify the species/taxonomic diversity of an assemblage. The sample‐size‐ and coverage‐based integrations of rarefaction (interpolation) and extrapo…
View article
The effect of travel restrictions on the spread of the 2019 novel coronavirus (COVID-19) outbreak Open
Outbreak to pandemic In response to global dispersion of severe acute respiratory syndrome–coronavirus 2 (SARS-CoV-2), quarantine measures have been implemented around the world. To understand how travel and quarantine influence the dynami…
View article
Carbon capture and storage (CCS): the way forward Open
Carbon capture and storage (CCS) is vital to climate change mitigation, and has application across the economy, in addition to facilitating atmospheric carbon dioxide removal resulting in emissions offsets and net negative emissions. This …
View article
ERA5-Land: a state-of-the-art global reanalysis dataset for land applications Open
Framed within the Copernicus Climate Change Service (C3S) of the European Commission, the European Centre for Medium-Range Weather Forecasts (ECMWF) is producing an enhanced global dataset for the land component of the fifth generation of …
View article
Incorporation of rubidium cations into perovskite solar cells improves photovoltaic performance Open
Improving the stability of perovskite solar cells Inorganic-organic perovskite solar cells have poor long-term stability because ultraviolet light and humidity degrade these materials. Bella et al. show that coating the cells with a water-…
View article
The biomass distribution on Earth Open
Significance The composition of the biosphere is a fundamental question in biology, yet a global quantitative account of the biomass of each taxon is still lacking. We assemble a census of the biomass of all kingdoms of life. This analysis…
View article
Microplastics in freshwater and terrestrial environments: Evaluating the current understanding to identify the knowledge gaps and future research priorities Open
Plastic debris is an environmentally persistent and complex contaminant of increasing concern. Understanding the sources, abundance and composition of microplastics present in the environment is a huge challenge due to the fact that hundre…
View article
Biodiversity redistribution under climate change: Impacts on ecosystems and human well-being Open
Consequences of shifting species distributions Climate change is causing geographical redistribution of plant and animal species globally. These distributional shifts are leading to new ecosystems and ecological communities, changes that w…
View article
A novel swarm intelligence optimization approach: sparrow search algorithm Open
In this paper, a novel swarm optimization approach, namely sparrow search algorithm (SSA), is proposed inspired by the group wisdom, foraging and anti-predation behaviours of sparrows. Experiments on 19 benchmark functions are conducted to…
View article
Product design and business model strategies for a circular economy Open
The transition within business from a linear to a circular economy brings with it a range of practical challenges for companies. The following question is addressed: What are the product design and business model strategies forcompanies th…
View article
The UNITE database for molecular identification of fungi: handling dark taxa and parallel taxonomic classifications Open
UNITE (https://unite.ut.ee/) is a web-based database and sequence management environment for the molecular identification of fungi. It targets the formal fungal barcode-the nuclear ribosomal internal transcribed spacer (ITS) region-and off…
View article
More than 75 percent decline over 27 years in total flying insect biomass in protected areas Open
Global declines in insects have sparked wide interest among scientists, politicians, and the general public. Loss of insect diversity and abundance is expected to provoke cascading effects on food webs and to jeopardize ecosystem services.…
View article
PubChem 2019 update: improved access to chemical data Open
PubChem (https://pubchem.ncbi.nlm.nih.gov) is a key chemical information resource for the biomedical research community. Substantial improvements were made in the past few years. New data content was added, including spectral information, …
View article
Primary Prevention of Cardiovascular Disease with a Mediterranean Diet Supplemented with Extra-Virgin Olive Oil or Nuts Open
In this study involving persons at high cardiovascular risk, the incidence of major cardiovascular events was lower among those assigned to a Mediterranean diet supplemented with extra-virgin olive oil or nuts than among those assigned to …
View article
Exact sequence variants should replace operational taxonomic units in marker-gene data analysis Open
Recent advances have made it possible to analyze high-throughput marker-gene sequencing data without resorting to the customary construction of molecular operational taxonomic units (OTUs): clusters of sequencing reads that differ by less …
View article
Emerging threats and persistent conservation challenges for freshwater biodiversity Open
In the 12 years since Dudgeon et al . (2006) reviewed major pressures on freshwater ecosystems, the biodiversity crisis in the world's lakes, reservoirs, rivers, streams and wetlands has deepened. While lakes, reservoirs and rivers cover o…
View article
Simple statistical identification and removal of contaminant sequences in marker-gene and metagenomics data Open
Decontam improves the quality of metagenomic and marker-gene sequencing by identifying and removing contaminant DNA sequences. Decontam integrates easily with existing MGS workflows and allows researchers to generate more accurate profiles…