Phylogenetics ≈ PhylogeneticsPhylogenetics
View article: MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets
MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets Open
We present the latest version of the Molecular Evolutionary Genetics Analysis (M ega ) software, which contains many sophisticated methods and tools for phylogenomics and phylomedicine. In this major upgrade, M ega has been optimized for u…
View article
Table 1 in A new Gammarus species from Xinjiang Uygur Autonomous Region (China) with a key to Xinjiang freshwater gammarids (Crustacea, Amphipoda, Gammaridae) Open
Table 1. Primer sequences of PCR products for target genes. GenePrimerSequence (5'-3')ReferenceCO1LCO1490GGTCAACAAATCATAAAGATATTGGFolmer et al. (1994)HCO2198TAAACTTCAGGGTGACCAAAAAATFolmer et al. (1994)LCO3TCNACHAAYCATAAAGAYATTGGTACKrebes e…
View article
Interactive Tree Of Life (iTOL) v5: an online tool for phylogenetic tree display and annotation Open
The Interactive Tree Of Life (https://itol.embl.de) is an online tool for the display, manipulation and annotation of phylogenetic and other trees. It is freely available and open to everyone. iTOL version 5 introduces a completely new tre…
View article
An update of the Angiosperm Phylogeny Group classification for the orders and families of flowering plants: APG IV Open
© 2016 The Linnean Society of London. An update of the Angiosperm Phylogeny Group (APG) classification of the orders and families of angiosperms is presented. Several new orders are recognized: Boraginales, Dilleniales, Icacinales, Metteni…
View article
Interactive Tree Of Life (iTOL) v4: recent updates and new developments Open
The Interactive Tree Of Life (https://itol.embl.de) is an online tool for the display, manipulation and annotation of phylogenetic and other trees. It is freely available and open to everyone. The current version introduces four new datase…
View article
PhyloSuite: An integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies Open
Multigene and genomic data sets have become commonplace in the field of phylogenetics, but many existing tools are not designed for such data sets, which often makes the analysis time‐consuming and tedious. Here, we present PhyloSuite , a …
View article
Genomic characterization of the 2019 novel human-pathogenic coronavirus isolated from a patient with atypical pneumonia after visiting Wuhan Open
A mysterious outbreak of atypical pneumonia in late 2019 was traced to a seafood wholesale market in Wuhan of China. Within a few weeks, a novel coronavirus tentatively named as 2019 novel coronavirus (2019-nCoV) was announced by the World…
View article
PANTHER version 14: more genomes, a new PANTHER GO-slim and improvements in enrichment analysis tools Open
PANTHER (Protein Analysis Through Evolutionary Relationships, http://pantherdb.org) is a resource for the evolutionary and functional classification of genes from organisms across the tree of life. We report the improvements we have made t…
View article
A taxonomic note on the genus Lactobacillus: Description of 23 novel genera, emended description of the genus Lactobacillus Beijerinck 1901, and union of Lactobacillaceae and Leuconostocaceae Open
The genus Lactobacillus comprises 261 species (at March 2020) that are extremely diverse at phenotypic, ecological and genotypic levels. This study evaluated the taxonomy of Lactobacillaceae and Leuconostocaceae on the basis of whole genom…
View article
ETE 3: Reconstruction, Analysis, and Visualization of Phylogenomic Data Open
The Environment for Tree Exploration (ETE) is a computational framework that simplifies the reconstruction, analysis, and visualization of phylogenetic trees and multiple sequence alignments. Here, we present ETE v3, featuring numerous imp…
View article
GTDB: an ongoing census of bacterial and archaeal diversity through a phylogenetically consistent, rank normalized and complete genome-based taxonomy Open
The Genome Taxonomy Database (GTDB; https://gtdb.ecogenomic.org) provides a phylogenetically consistent and rank normalized genome-based taxonomy for prokaryotic genomes sourced from the NCBI Assembly database. GTDB R06-RS202 spans 254 090…
View article
A new view of the tree of life Open
The tree of life is one of the most important organizing principles in biology 1 . Gene surveys suggest the existence of an enormous number of branches 2 , but even an approximation of the full scale of the tree has remained elusive. Recen…
View article
<span>PANTHER</span>: Making genome‐scale phylogenetics accessible to all Open
Phylogenetics is a powerful tool for analyzing protein sequences, by inferring their evolutionary relationships to other proteins. However, phylogenetics analyses can be challenging: they are computationally expensive and must be performed…
View article
On the origin and continuing evolution of SARS-CoV-2 Open
The SARS-CoV-2 epidemic started in late December 2019 in Wuhan, China, and has since impacted a large portion of China and raised major global concern. Herein, we investigated the extent of molecular divergence between SARS-CoV-2 and other…
View article
TreeTime: Maximum-likelihood phylodynamic analysis Open
Mutations that accumulate in the genome of cells or viruses can be used to infer their evolutionary history. In the case of rapidly evolving organisms, genomes can reveal their detailed spatiotemporal spread. Such phylodynamic analyses are…
View article
A phylum-level phylogenetic classification of zygomycete fungi based on genome-scale data Open
Zygomycete fungi were classified as a single phylum, Zygomycota, based on sexual reproduction by zygospores, frequent asexual reproduction by sporangia, absence of multicellular sporocarps, and production of coenocytic hyphae, all with som…
View article
Genetic Analysis of Human Norovirus Strains in Japan in 2016–2017 Open
In the 2016/2017 winter season in Japan, HuNoV GII.P16-GII.2 strains (2016 strains) emerged and caused large outbreaks of acute gastroenteritis. To better understand the outbreaks, we examined the molecular evolution of the VP1 gene and Rd…
View article
Thousands of microbial genomes shed light on interconnected biogeochemical processes in an aquifer system Open
The subterranean world hosts up to one-fifth of all biomass, including microbial communities that drive transformations central to Earth’s biogeochemical cycles. However, little is known about how complex microbial communities in such envi…
View article
Inferring the mammal tree: Species-level sets of phylogenies for questions in ecology, evolution, and conservation Open
Big, time-scaled phylogenies are fundamental to connecting evolutionary processes to modern biodiversity patterns. Yet inferring reliable phylogenetic trees for thousands of species involves numerous trade-offs that have limited their util…
View article
Phylogenetic network analysis of SARS-CoV-2 genomes Open
Significance This is a phylogenetic network of SARS-CoV-2 genomes sampled from across the world. These genomes are closely related and under evolutionary selection in their human hosts, sometimes with parallel evolution events, that is, th…
View article
Constructing a broadly inclusive seed plant phylogeny Open
Premise of the Study Large phylogenies can help shed light on macroevolutionary patterns that inform our understanding of fundamental processes that shape the tree of life. These phylogenies also serve as tools that facilitate other system…
View article
V.PhyloMaker: an R package that can generate very large phylogenies for vascular plants Open
We present V.PhyloMaker, a freely available package for R designed to generate phylogenies for vascular plants. The mega‐tree implemented in V.PhyloMaker (i.e. GBOTB.extended.tre), which was derived from two recently published mega‐trees a…
View article
A new subfamily classification of the Leguminosae based on a taxonomically comprehensive phylogeny: The Legume Phylogeny Working Group (LPWG) Open
The classification of the legume family proposed here addresses the long‐known non‐monophyly of the traditionally recognised subfamily Caesalpinioideae, by recognising six robustly supported monophyletic subfamilies. This new classificatio…
View article
Discovery of a rich gene pool of bat SARS-related coronaviruses provides new insights into the origin of SARS coronavirus Open
A large number of SARS-related coronaviruses (SARSr-CoV) have been detected in horseshoe bats since 2005 in different areas of China. However, these bat SARSr-CoVs show sequence differences from SARS coronavirus (SARS-CoV) in different gen…
View article
Cross‐species transmission of the newly identified coronavirus 2019‐nCoV Open
The current outbreak of viral pneumonia in the city of Wuhan, China, was caused by a novel coronavirus designated 2019‐nCoV by the World Health Organization, as determined by sequencing the viral RNA genome. Many initial patients were expo…
View article
The EnteroBase user's guide, with case studies on <i>Salmonella</i> transmissions, <i>Yersinia pestis</i> phylogeny, and <i>Escherichia</i> core genomic diversity Open
EnteroBase is an integrated software environment that supports the identification of global population structures within several bacterial genera that include pathogens. Here, we provide an overview of how EnteroBase works, what it can do,…
View article
Tree Visualization By One Table (tvBOT): a web application for visualizing, modifying and annotating phylogenetic trees Open
tvBOT is a user-friendly and efficient web application for visualizing, modifying, and annotating phylogenetic trees. It is highly efficient in data preparation without requiring redundant style and syntax data. Tree annotations are powere…
View article
Multispecies coalescent delimits structure, not species Open
Significance Despite its widespread application to the species delimitation problem, our study demonstrates that what the multispecies coalescent actually delimits is structure. The current implementations of species delimitation under the…
View article
Large-scale generation and analysis of filamentous fungal DNA barcodes boosts coverage for kingdom fungi and reveals thresholds for fungal species and higher taxon delimitation Open
Species identification lies at the heart of biodiversity studies that has in recent years favoured DNA-based approaches. Microbial Biological Resource Centres are a rich source for diverse and high-quality reference materials in microbiolo…
View article
Muscle5: High-accuracy alignment ensembles enable unbiased assessments of sequence homology and phylogeny Open
Multiple sequence alignments are widely used to infer evolutionary relationships, enabling inferences of structure, function, and phylogeny. Standard practice is to construct one alignment by some preferred method and use it in further ana…